Sample ID: FungusA_ITS
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:13 |
| Analysis completed | 2025-05-03 01:28:13 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1C] >3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1C) Fungi. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
No taxa of interest provided at rank genus/species
| Locus | ITS |
| Preliminary ID | Fungi |
| Taxa of interest | |
| Country | Australia |
| Host | Cannabis sativa |
| Sample ID | FungusA_ITS |
| Query DNA sequence |
>FungusA_ITS GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTCATATATGC GAAGGAGTTGTGCTGGTAATGAATATTGCATGTGCACACTCTGGAGCTATATAATATATA CACCTGTGAACCAACTGTAGTCAGGAGAAATCCTAACTATGATYACCCTATATAACTCTT ATTGTATGTTACATAGAACGATCTCATATTGAAACTTTGTTTTCTGACAAGTTTCTCTTA ATTAAAAAATATACAACTTTCAACAACGGATCTCTTGGCTCTTGCATCGATGAAGAACGC AGCGAAATGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACG CACCTTGCGCCCTTTGGTATTCCGAGGGGCATGCCTGTTTGAGAGTCATTAAATTCTCAA CCTTACAAATTTTTGTATTTGTCAAGGCTTGGATGTGAGAGTTGCTGGTTAGAGTATATT CTGACTGGCTCTCTTTAAAACTATTAGTAGGACATGTAGAAATGCCTACGGTTGGTGTGA TAATATGTCTACGCCTATACCGGAAGGGGATTCTAGCTTGTATGTACTACTTATAAAATC ATGCGCATATATCTAGCATATAAGTGCATATATTGACCATTTGACCTCAAATCAGGTAGG ACTACCCGCTGAACTTAA
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 278 | 4 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Agroathelia rolfsii | 274 | 99.9% | 0.0 |
Database coverage of Candidate Agroathelia rolfsiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Agroathelia sp. | 1 | 99.7% | 0.0 |
Database coverage of Candidate Agroathelia sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Agroathelia delphinii | 2 | 99.6% | 0.0 |
Database coverage of Candidate Agroathelia delphiniiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| uncultured Athelia | 1 | 99.5% | 0.0 |
Database coverage of Candidate uncultured AtheliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | PP391657 | Agroathelia rolfsii isolate AK1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1340.5 | 0.00e+00 | 99.9% |
| 2 | MW350729 | Agroathelia rolfsii isolate GKVK-beetroot small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1340.5 | 0.00e+00 | 99.9% |
| 3 | MW349663 | Agroathelia rolfsii isolate GKVK Ragi small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 673 | 99.3% | 1330.59 | 0.00e+00 | 99.9% |
| 4 | MN696630 | Agroathelia rolfsii isolate SR YLB Kerala internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 95.1% | 1406.407 | 0.00e+00 | 99.9% |
| 5 | KU514412 | Agroathelia rolfsii isolate SrKK17_1090 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 666 | 98.2% | 1316.71 | 0.00e+00 | 99.8% |
| 6 | OM647806 | Athelia rolfsii isolate YKY2020.02 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1316.71 | 0.00e+00 | 99.8% |
| 7 | HQ420816 | Athelia rolfsii isolate SR001 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1312.75 | 0.00e+00 | 99.8% |
| 8 | JN017199 | Athelia rolfsii strain 09-044 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1312.75 | 0.00e+00 | 99.8% |
| 9 | OM729592 | Athelia rolfsii isolate Ssr small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 663 | 97.8% | 1310.77 | 0.00e+00 | 99.8% |
| 10 | OR981874 | Agroathelia rolfsii isolate KACC45483_C9 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 660 | 97.3% | 1304.82 | 0.00e+00 | 99.8% |
| 11 | MH517363 | Agroathelia rolfsii isolate AV5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 655 | 96.6% | 1294.91 | 0.00e+00 | 99.8% |
| 12 | GQ121442 | Athelia rolfsii strain SM 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 95.1% | 1275.09 | 0.00e+00 | 99.8% |
| 13 | OL851829 | Athelia rolfsii isolate Kalyani isolate 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 641 | 94.5% | 1267.16 | 0.00e+00 | 99.8% |
| 14 | JN241562 | Athelia rolfsii isolate 3083 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 94.2% | 1263.19 | 0.00e+00 | 99.8% |
| 15 | ON206899 | Athelia rolfsii isolate Sr.1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 639 | 94.2% | 1263.19 | 0.00e+00 | 99.8% |
| 16 | JN241564 | Athelia rolfsii isolate 176 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 94.2% | 1263.19 | 0.00e+00 | 99.8% |
| 17 | PP908470 | Agroathelia rolfsii isolate GAHaSr-2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 630 | 92.9% | 1245.35 | 0.00e+00 | 99.8% |
| 18 | PP908471 | Agroathelia rolfsii isolate MKHaSr-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 630 | 92.9% | 1245.35 | 0.00e+00 | 99.8% |
| 19 | PP908469 | Agroathelia rolfsii isolate BAHaSr-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 630 | 92.9% | 1245.35 | 0.00e+00 | 99.8% |
| 20 | PP908473 | Agroathelia rolfsii isolate DPHaSr-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 629 | 92.8% | 1243.37 | 0.00e+00 | 99.8% |
| 21 | HQ895894 | Athelia rolfsii strain HUGS16-1T1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 621 | 91.6% | 1227.51 | 0.00e+00 | 99.8% |
| 22 | PP908472 | Agroathelia rolfsii isolate PhaKHaSr-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 91.4% | 1225.53 | 0.00e+00 | 99.8% |
| 23 | KC867346 | Athelia rolfsii strain fbsr1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 90.9% | 1217.6 | 0.00e+00 | 99.8% |
| 24 | MN121366 | Agroathelia rolfsii isolate TUB internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 90.9% | 1217.6 | 0.00e+00 | 99.8% |
| 25 | KC867342 | Athelia rolfsii strain tomsr1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 90.9% | 1217.6 | 0.00e+00 | 99.8% |
| 26 | KC894858 | Athelia rolfsii strain POSR internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 90.9% | 1217.6 | 0.00e+00 | 99.8% |
| 27 | OM681412 | Athelia rolfsii isolate Kalyani iso-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 90.9% | 1217.6 | 0.00e+00 | 99.8% |
| 28 | KC894859 | Athelia rolfsii strain PoH internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 615 | 90.7% | 1215.62 | 0.00e+00 | 99.8% |
| 29 | MN121388 | Agroathelia rolfsii isolate POT1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 615 | 90.7% | 1215.62 | 0.00e+00 | 99.8% |
| 30 | MN121367 | Agroathelia rolfsii isolate BCL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 615 | 90.7% | 1215.62 | 0.00e+00 | 99.8% |
| 31 | KC894861 | Athelia rolfsii strain EFY3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 614 | 90.6% | 1213.64 | 0.00e+00 | 99.8% |
| 32 | KC894857 | Athelia rolfsii strain srpo1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 614 | 90.6% | 1213.64 | 0.00e+00 | 99.8% |
| 33 | MN121389 | Agroathelia rolfsii isolate CWP1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 613 | 90.4% | 1211.65 | 0.00e+00 | 99.8% |
| 34 | MN121418 | Agroathelia rolfsii isolate CKP1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 613 | 90.4% | 1211.65 | 0.00e+00 | 99.8% |
| 35 | KC460985 | Athelia rolfsii strain srpo3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 613 | 90.4% | 1211.65 | 0.00e+00 | 99.8% |
| 36 | HQ895937 | Athelia rolfsii strain QNGC17T1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 613 | 90.4% | 1211.65 | 0.00e+00 | 99.8% |
| 37 | KC867345 | Athelia rolfsii strain parsr1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 613 | 90.4% | 1211.65 | 0.00e+00 | 99.8% |
| 38 | OR514121 | Agroathelia rolfsii isolate Scr12 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 612 | 90.3% | 1209.67 | 0.00e+00 | 99.8% |
| 39 | MN121365 | Agroathelia rolfsii isolate LNT2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 612 | 90.3% | 1209.67 | 0.00e+00 | 99.8% |
| 40 | HQ895950 | Athelia rolfsii strain QNGS86T1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 611 | 90.1% | 1207.69 | 0.00e+00 | 99.8% |
| 41 | MN577233 | Agroathelia rolfsii isolate LOP1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 90.1% | 1207.69 | 0.00e+00 | 99.8% |
| 42 | OR514127 | Agroathelia rolfsii isolate Scr49 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 89.7% | 1201.74 | 0.00e+00 | 99.8% |
| 43 | PP659527 | Agroathelia rolfsii isolate DZAS-01 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 607 | 89.5% | 1199.76 | 0.00e+00 | 99.8% |
| 44 | HQ895944 | Athelia rolfsii strain QNGS13T1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 606 | 89.4% | 1197.78 | 0.00e+00 | 99.8% |
| 45 | HQ895936 | Athelia rolfsii strain QNGC9T1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 602 | 88.8% | 1189.85 | 0.00e+00 | 99.8% |
| 46 | HQ895946 | Athelia rolfsii strain QNGC002-2T1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 600 | 88.5% | 1185.89 | 0.00e+00 | 99.8% |
| 47 | MN121187 | Agroathelia rolfsii isolate CHI-2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 599 | 88.3% | 1183.9 | 0.00e+00 | 99.8% |
| 48 | DQ484061 | Athelia rolfsii isolate AFTOL-ID 664 clone 2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 596 | 87.9% | 1177.96 | 0.00e+00 | 99.8% |
| 49 | OR497734 | Agroathelia rolfsii isolate SrK internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 590 | 87.0% | 1166.06 | 0.00e+00 | 99.8% |
| 50 | HQ895959 | Athelia rolfsii strain QNTS13T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 581 | 85.7% | 1148.22 | 0.00e+00 | 99.8% |
| 51 | HQ895923 | Athelia rolfsii strain HTGS9T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 579 | 85.4% | 1144.26 | 0.00e+00 | 99.8% |
| 52 | HQ895938 | Athelia rolfsii strain QNGC28T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 573 | 84.5% | 1132.36 | 0.00e+00 | 99.8% |
| 53 | KX757771 | Agroathelia rolfsii strain CSAEGro-CaDIA internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 570 | 84.1% | 1126.42 | 0.00e+00 | 99.8% |
| 54 | OR885525 | Agroathelia rolfsii isolate SR 3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 560 | 82.6% | 1106.59 | 0.00e+00 | 99.8% |
| 55 | PQ456073 | Agroathelia rolfsii isolate Ar-12 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 558 | 82.3% | 1102.63 | 0.00e+00 | 99.8% |
| 56 | OL348356 | Agroathelia rolfsii isolate Src1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 553 | 81.6% | 1092.72 | 0.00e+00 | 99.8% |
| 57 | OR504447 | Agroathelia rolfsii isolate Oat P internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 552 | 81.4% | 1090.74 | 0.00e+00 | 99.8% |
| 58 | PQ168934 | Agroathelia rolfsii isolate CSAEG-SrCp internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 546 | 80.5% | 1078.84 | 0.00e+00 | 99.8% |
| 59 | KX231834 | Agroathelia rolfsii strain MOR1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 544 | 80.2% | 1074.88 | 0.00e+00 | 99.8% |
| 60 | MK411221 | Agroathelia rolfsii culture CPC:23947 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1330.59 | 0.00e+00 | 99.7% |
| 61 | MZ242240 | Agroathelia rolfsii isolate Acsc3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 676 | 99.7% | 1326.63 | 0.00e+00 | 99.7% |
| 62 | MZ242241 | Agroathelia rolfsii isolate Acsc5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 676 | 99.7% | 1326.63 | 0.00e+00 | 99.7% |
| 63 | MH513999 | Agroathelia rolfsii isolate DU-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 675 | 99.6% | 1324.64 | 0.00e+00 | 99.7% |
| 64 | MN609999 | Agroathelia rolfsii isolate MSB1-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1308.79 | 0.00e+00 | 99.7% |
| 65 | OR981873 | Agroathelia rolfsii isolate KACC45483_C8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1304.82 | 0.00e+00 | 99.7% |
| 66 | KX186998 | Agroathelia rolfsii isolate Sc-03 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1304.82 | 0.00e+00 | 99.7% |
| 67 | OR981862 | Agroathelia rolfsii isolate KACC43065_C5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1304.82 | 0.00e+00 | 99.7% |
| 68 | OR981864 | Agroathelia rolfsii isolate KACC43065_C8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1304.82 | 0.00e+00 | 99.7% |
| 69 | KU760984 | Athelia rolfsii isolate MHGNU F118 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1304.82 | 0.00e+00 | 99.7% |
| 70 | PP697755 | Agroathelia rolfsii strain BW2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1304.82 | 0.00e+00 | 99.7% |
| 71 | OR981871 | Agroathelia rolfsii isolate KACC45483_C5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1304.82 | 0.00e+00 | 99.7% |
| 72 | GU080230 | Athelia rolfsii strain A8.2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 665 | 98.1% | 1304.82 | 0.00e+00 | 99.7% |
| 73 | KJ546416 | Athelia rolfsii isolate BOScR-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1302.84 | 0.00e+00 | 99.7% |
| 74 | KU128903 | Agroathelia rolfsii strain SR1USVL 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1302.84 | 0.00e+00 | 99.7% |
| 75 | KY175225 | Agroathelia rolfsii isolate C13 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 663 | 97.8% | 1300.86 | 0.00e+00 | 99.7% |
| 76 | AY684917 | Athelia rolfsii strain FSR-052 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 662 | 97.6% | 1300.86 | 0.00e+00 | 99.7% |
| 77 | EU338381 | Athelia rolfsii isolate SR-SC1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 659 | 97.2% | 1294.91 | 0.00e+00 | 99.7% |
| 78 | OQ753277 | Athelia rolfsii isolate GSR6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 658 | 97.1% | 1290.95 | 0.00e+00 | 99.7% |
| 79 | KP784421 | Athelia rolfsii strain A internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 655 | 96.6% | 1286.98 | 0.00e+00 | 99.7% |
| 80 | OR514115 | Agroathelia rolfsii isolate Scr6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 650 | 95.9% | 1275.09 | 0.00e+00 | 99.7% |
| 81 | AB075300 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 1T11 | 645 | 95.1% | 1265.18 | 0.00e+00 | 99.7% |
| 82 | MF425542 | Agroathelia rolfsii isolate LPS01004 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 95.1% | 1265.18 | 0.00e+00 | 99.7% |
| 83 | DQ059578 | Athelia rolfsii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 95.1% | 1265.18 | 0.00e+00 | 99.7% |
| 84 | AB075303 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 138T7 | 645 | 95.1% | 1265.18 | 0.00e+00 | 99.7% |
| 85 | JN241556 | Athelia rolfsii isolate 3095 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1255.26 | 0.00e+00 | 99.7% |
| 86 | JN241563 | Athelia rolfsii isolate AS-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 94.2% | 1253.28 | 0.00e+00 | 99.7% |
| 87 | OM510466 | Athelia rolfsii isolate FAVF647 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 93.8% | 1247.34 | 0.00e+00 | 99.7% |
| 88 | MN121364 | Agroathelia rolfsii isolate CHI_2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 92.0% | 1223.55 | 0.00e+00 | 99.7% |
| 89 | MT634388 | Agroathelia rolfsii strain SRNN1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 92.0% | 1223.55 | 0.00e+00 | 99.7% |
| 90 | PP905407 | Agroathelia sp. isolate SWUSTp-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 90.9% | 1207.69 | 0.00e+00 | 99.7% |
| 91 | OR514122 | Agroathelia rolfsii isolate Scr13 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 610 | 90.0% | 1197.78 | 0.00e+00 | 99.7% |
| 92 | AY726620 | Athelia rolfsii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 610 | 90.0% | 1195.8 | 0.00e+00 | 99.7% |
| 93 | OR514129 | Agroathelia rolfsii isolate Scr51 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 609 | 89.8% | 1193.81 | 0.00e+00 | 99.7% |
| 94 | OR514126 | Agroathelia rolfsii isolate Scr48 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 89.7% | 1191.83 | 0.00e+00 | 99.7% |
| 95 | MN121349 | Agroathelia rolfsii isolate LTR1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 607 | 89.5% | 1189.85 | 0.00e+00 | 99.7% |
| 96 | MK721539 | Agroathelia rolfsii isolate DAR3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 604 | 89.1% | 1183.9 | 0.00e+00 | 99.7% |
| 97 | OR514125 | Agroathelia rolfsii isolate Scr47 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 602 | 88.8% | 1179.94 | 0.00e+00 | 99.7% |
| 98 | KF724852 | Athelia rolfsii strain SR1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 601 | 88.6% | 1177.96 | 0.00e+00 | 99.7% |
| 99 | MK721537 | Agroathelia rolfsii isolate DAR1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 600 | 88.5% | 1175.97 | 0.00e+00 | 99.7% |
| 100 | OL583986 | Agroathelia rolfsii isolate QJ-01 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 593 | 87.5% | 1168.04 | 0.00e+00 | 99.7% |
| 101 | OR514118 | Agroathelia rolfsii isolate Scr9 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 589 | 86.9% | 1154.17 | 0.00e+00 | 99.7% |
| 102 | HQ895933 | Athelia rolfsii strain NAGC18T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 588 | 86.7% | 1152.19 | 0.00e+00 | 99.7% |
| 103 | HQ895943 | Athelia rolfsii strain QNGS8T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 585 | 86.3% | 1146.24 | 0.00e+00 | 99.7% |
| 104 | HQ895931 | Athelia rolfsii strain NAGC12T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 583 | 86.0% | 1142.28 | 0.00e+00 | 99.7% |
| 105 | HQ895905 | Athelia rolfsii strain HTGC5T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 582 | 85.8% | 1140.29 | 0.00e+00 | 99.7% |
| 106 | HQ895953 | Athelia rolfsii strain QNGS40T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 582 | 85.8% | 1140.29 | 0.00e+00 | 99.7% |
| 107 | HQ895935 | Athelia rolfsii strain QNGC61T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 581 | 85.7% | 1138.31 | 0.00e+00 | 99.7% |
| 108 | HQ895877 | Athelia rolfsii strain HUGC10-1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 578 | 85.3% | 1132.36 | 0.00e+00 | 99.7% |
| 109 | HQ895872 | Athelia rolfsii strain HUGC7T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 578 | 85.3% | 1132.36 | 0.00e+00 | 99.7% |
| 110 | HQ895897 | Athelia rolfsii strain HUGS11T2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 577 | 85.1% | 1130.38 | 0.00e+00 | 99.7% |
| 111 | HQ895928 | Athelia rolfsii strain HTGS23T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 577 | 85.1% | 1130.38 | 0.00e+00 | 99.7% |
| 112 | HQ895896 | Athelia rolfsii strain HUGS5T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 577 | 85.1% | 1130.38 | 0.00e+00 | 99.7% |
| 113 | HQ895871 | Athelia rolfsii strain HUGS1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 577 | 85.1% | 1130.38 | 0.00e+00 | 99.7% |
| 114 | HQ895885 | Athelia rolfsii strain HUGS4T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 576 | 85.0% | 1128.4 | 0.00e+00 | 99.7% |
| 115 | OR514123 | Agroathelia rolfsii isolate Scr14 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 576 | 85.0% | 1128.4 | 0.00e+00 | 99.7% |
| 116 | HQ895912 | Athelia rolfsii strain NAGC27T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 576 | 85.0% | 1128.4 | 0.00e+00 | 99.7% |
| 117 | HQ895878 | Athelia rolfsii strain HUGC9T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 575 | 84.8% | 1126.42 | 0.00e+00 | 99.7% |
| 118 | HQ895960 | Athelia rolfsii strain QNGC73T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 575 | 84.8% | 1126.42 | 0.00e+00 | 99.7% |
| 119 | HQ895954 | Athelia rolfsii strain QNGC16T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 575 | 84.8% | 1126.42 | 0.00e+00 | 99.7% |
| 120 | HQ895874 | Athelia rolfsii strain HUTC1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 575 | 84.8% | 1126.42 | 0.00e+00 | 99.7% |
| 121 | HQ895921 | Athelia rolfsii strain HTGC13-1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 574 | 84.7% | 1124.44 | 0.00e+00 | 99.7% |
| 122 | HQ895868 | Athelia rolfsii strain RH001 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 574 | 84.7% | 1124.44 | 0.00e+00 | 99.7% |
| 123 | HQ895875 | Athelia rolfsii strain HUMC22T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 574 | 84.7% | 1124.44 | 0.00e+00 | 99.7% |
| 124 | HQ895949 | Athelia rolfsii strain QNMS25T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 574 | 84.7% | 1124.44 | 0.00e+00 | 99.7% |
| 125 | HQ895908 | Athelia rolfsii strain NAGC9T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 574 | 84.7% | 1124.44 | 0.00e+00 | 99.7% |
| 126 | HQ895917 | Athelia rolfsii strain NAGS1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 574 | 84.7% | 1124.44 | 0.00e+00 | 99.7% |
| 127 | HQ895891 | Athelia rolfsii strain HUGS16-2T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 573 | 84.5% | 1122.45 | 0.00e+00 | 99.7% |
| 128 | HQ895886 | Athelia rolfsii strain HUGS12T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 572 | 84.4% | 1120.47 | 0.00e+00 | 99.7% |
| 129 | HQ895884 | Athelia rolfsii strain HUMC20T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 572 | 84.4% | 1120.47 | 0.00e+00 | 99.7% |
| 130 | HQ895873 | Athelia rolfsii strain HUGC27T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 572 | 84.4% | 1120.47 | 0.00e+00 | 99.7% |
| 131 | PP212963 | Agroathelia rolfsii isolate Mandya small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1326.63 | 0.00e+00 | 99.6% |
| 132 | MK073010 | Agroathelia delphinii isolate W-SD6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1324.64 | 0.00e+00 | 99.6% |
| 133 | HQ895925 | Athelia rolfsii strain HTGS17T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 571 | 84.2% | 1118.49 | 0.00e+00 | 99.6% |
| 134 | HQ895918 | Athelia rolfsii strain NAGC13T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 571 | 84.2% | 1118.49 | 0.00e+00 | 99.6% |
| 135 | HQ895899 | Athelia rolfsii strain HUGC21T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 571 | 84.2% | 1118.49 | 0.00e+00 | 99.6% |
| 136 | HQ895927 | Athelia rolfsii strain HTGS20T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 570 | 84.1% | 1116.51 | 0.00e+00 | 99.6% |
| 137 | HQ895907 | Athelia rolfsii strain NAGC1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 570 | 84.1% | 1116.51 | 0.00e+00 | 99.6% |
| 138 | HQ895966 | Athelia rolfsii strain HUGC7T2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 570 | 84.1% | 1116.51 | 0.00e+00 | 99.6% |
| 139 | HQ895911 | Athelia rolfsii strain NAGC22T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 569 | 83.9% | 1114.52 | 0.00e+00 | 99.6% |
| 140 | HQ895956 | Athelia rolfsii strain QNGS1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 569 | 83.9% | 1114.52 | 0.00e+00 | 99.6% |
| 141 | HQ895915 | Athelia rolfsii strain NATC1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 569 | 83.9% | 1114.52 | 0.00e+00 | 99.6% |
| 142 | HQ895913 | Athelia rolfsii strain NAGS2-1T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 568 | 83.8% | 1112.54 | 0.00e+00 | 99.6% |
| 143 | HQ895926 | Athelia rolfsii strain HTGS18T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 568 | 83.8% | 1112.54 | 0.00e+00 | 99.6% |
| 144 | OR514116 | Agroathelia rolfsii isolate Scr7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 567 | 83.6% | 1110.56 | 0.00e+00 | 99.6% |
| 145 | OR514112 | Agroathelia rolfsii isolate Scr3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 566 | 83.5% | 1108.58 | 0.00e+00 | 99.6% |
| 146 | HQ895887 | Athelia rolfsii strain HUGC30T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 565 | 83.3% | 1106.59 | 0.00e+00 | 99.6% |
| 147 | HQ895952 | Athelia rolfsii strain QNGC5T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 563 | 83.0% | 1102.63 | 0.00e+00 | 99.6% |
| 148 | HQ895865 | Athelia rolfsii strain QNGC22T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 563 | 83.0% | 1102.63 | 0.00e+00 | 99.6% |
| 149 | HQ895958 | Athelia rolfsii strain QNGS2T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 562 | 82.9% | 1100.65 | 0.00e+00 | 99.6% |
| 150 | MN833953 | Agroathelia rolfsii isolate BCKV_gen internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 561 | 82.7% | 1100.65 | 0.00e+00 | 99.6% |
| 151 | HQ895961 | Athelia rolfsii strain QNGC19-2T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 560 | 82.6% | 1096.68 | 0.00e+00 | 99.6% |
| 152 | HQ895942 | Athelia rolfsii strain QNGC3T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 558 | 82.3% | 1092.72 | 0.00e+00 | 99.6% |
| 153 | HQ895967 | Athelia rolfsii strain QNGS38-2T1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 554 | 81.7% | 1084.79 | 0.00e+00 | 99.6% |
| 154 | HQ895867 | Athelia rolfsii strain H001 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 550 | 81.1% | 1076.86 | 0.00e+00 | 99.6% |
| 155 | OP279917 | Athelia rolfsii isolate YKY2020.03 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1300.86 | 0.00e+00 | 99.5% |
| 156 | OP279918 | Athelia rolfsii isolate YKY2020.07 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1298.87 | 0.00e+00 | 99.5% |
| 157 | JN081867 | Athelia rolfsii strain SR01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1294.91 | 0.00e+00 | 99.5% |
| 158 | KP257581 | Athelia rolfsii strain KACC 47820 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 662 | 97.6% | 1292.93 | 0.00e+00 | 99.5% |
| 159 | AF499018 | Athelia rolfsii strain ATCC 201126 18S ribosomal RNA, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA, partial sequence | 662 | 97.6% | 1290.95 | 0.00e+00 | 99.5% |
| 160 | KC420510 | Athelia rolfsii isolate SS-08 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 653 | 96.3% | 1275.09 | 0.00e+00 | 99.5% |
| 161 | KY446393 | Agroathelia rolfsii strain SPL15002 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 654 | 96.5% | 1275.09 | 0.00e+00 | 99.5% |
| 162 | KY446392 | Agroathelia rolfsii strain SPL15004 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 653 | 96.3% | 1273.1 | 0.00e+00 | 99.5% |
| 163 | OR514114 | Agroathelia rolfsii isolate Scr5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 650 | 95.9% | 1267.16 | 0.00e+00 | 99.5% |
| 164 | KC420512 | Athelia rolfsii isolate SS-10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 649 | 95.7% | 1267.16 | 0.00e+00 | 99.5% |
| 165 | AB075306 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 138T13 | 645 | 95.1% | 1257.25 | 0.00e+00 | 99.5% |
| 166 | AB075304 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 138T9 | 645 | 95.1% | 1257.25 | 0.00e+00 | 99.5% |
| 167 | GQ215695 | Athelia rolfsii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1247.34 | 0.00e+00 | 99.5% |
| 168 | JN241554 | Athelia rolfsii isolate SR1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1247.34 | 0.00e+00 | 99.5% |
| 169 | KY446390 | Agroathelia rolfsii strain SPL15006 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 631 | 93.1% | 1229.5 | 0.00e+00 | 99.5% |
| 170 | KY446381 | Agroathelia rolfsii strain SPL16057 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 629 | 92.8% | 1225.53 | 0.00e+00 | 99.5% |
| 171 | KY446386 | Agroathelia rolfsii strain SPL16005 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 627 | 92.5% | 1221.57 | 0.00e+00 | 99.5% |
| 172 | KY446394 | Agroathelia rolfsii strain SPL15001 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 624 | 92.0% | 1215.62 | 0.00e+00 | 99.5% |
| 173 | MZ750978 | Agroathelia rolfsii strain LB5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 91.7% | 1211.65 | 0.00e+00 | 99.5% |
| 174 | MK721538 | Agroathelia rolfsii isolate DAR2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 90.9% | 1201.74 | 0.00e+00 | 99.5% |
| 175 | OR514124 | Agroathelia rolfsii isolate Scr17 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 612 | 90.3% | 1191.83 | 0.00e+00 | 99.5% |
| 176 | KY620035 | Agroathelia rolfsii strain Costa Rica (1778) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 607 | 89.5% | 1181.92 | 0.00e+00 | 99.5% |
| 177 | DQ484062 | Athelia rolfsii isolate AFTOL-ID 664 clone 3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 596 | 87.9% | 1162.1 | 0.00e+00 | 99.5% |
| 178 | OR514117 | Agroathelia rolfsii isolate Scr8 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 583 | 86.0% | 1134.35 | 0.00e+00 | 99.5% |
| 179 | HQ895963 | Athelia rolfsii strain HUGC7T3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 560 | 82.6% | 1088.75 | 0.00e+00 | 99.5% |
| 180 | FM866386 | Uncultured Athelia ITS1, 5.8S rRNA gene and ITS2, clone B10-1 | 552 | 81.4% | 1074.88 | 0.00e+00 | 99.5% |
| 181 | MN699473 | Agroathelia rolfsii isolate Foc-76 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 550 | 81.1% | 1068.93 | 0.00e+00 | 99.5% |
| 182 | MZ956758 | Agroathelia rolfsii isolate LHBJ2-4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1316.71 | 0.00e+00 | 99.4% |
| 183 | GU567775 | Sclerotium delphinii strain CBA-HW05 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 678 | 100.0% | 1316.71 | 0.00e+00 | 99.4% |
| 184 | MH854711 | Athelia rolfsii culture CBS:115.22 strain CBS 115.22 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 673 | 99.3% | 1304.82 | 0.00e+00 | 99.4% |
| 185 | MN380242 | Agroathelia rolfsii isolate DQ small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1292.93 | 0.00e+00 | 99.4% |
| 186 | JF819727 | Athelia rolfsii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1288.96 | 0.00e+00 | 99.4% |
| 187 | OR981868 | Agroathelia rolfsii isolate KACC45483_C2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1288.96 | 0.00e+00 | 99.4% |
| 188 | HQ895869 | Athelia rolfsii strain HUGS18T1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 655 | 96.6% | 1271.12 | 0.00e+00 | 99.4% |
| 189 | MW093622 | Agroathelia rolfsii isolate HML small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 653 | 96.3% | 1271.12 | 0.00e+00 | 99.4% |
| 190 | FJ968783 | Athelia rolfsii strain S-07 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 654 | 96.5% | 1267.16 | 0.00e+00 | 99.4% |
| 191 | OQ608633 | Athelia rolfsii isolate ArGS3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 649 | 95.7% | 1265.18 | 0.00e+00 | 99.4% |
| 192 | KY446385 | Agroathelia rolfsii strain SPL16006 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 651 | 96.0% | 1261.21 | 0.00e+00 | 99.4% |
| 193 | HQ895870 | Athelia rolfsii strain HUGS18T2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 650 | 95.9% | 1261.21 | 0.00e+00 | 99.4% |
| 194 | KC420511 | Athelia rolfsii isolate SS-09 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 647 | 95.4% | 1257.25 | 0.00e+00 | 99.4% |
| 195 | AB075290 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 63T16 | 645 | 95.1% | 1251.3 | 0.00e+00 | 99.4% |
| 196 | PP467723 | Agroathelia rolfsii strain EGY-SR1422 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 95.1% | 1249.32 | 0.00e+00 | 99.4% |
| 197 | JN241560 | Athelia rolfsii isolate 1125 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 94.2% | 1239.41 | 0.00e+00 | 99.4% |
| 198 | KX434526 | Agroathelia rolfsii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 639 | 94.2% | 1237.42 | 0.00e+00 | 99.4% |
| 199 | PP703154 | Agroathelia rolfsii isolate SrCHR internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 630 | 92.9% | 1221.57 | 0.00e+00 | 99.4% |
| 200 | KX711545 | Agroathelia rolfsii strain Tari f215028 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 629 | 92.8% | 1221.57 | 0.00e+00 | 99.4% |
| 201 | HM222638 | Athelia rolfsii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 630 | 92.9% | 1217.6 | 0.00e+00 | 99.4% |
| 202 | PV163297 | Agroathelia rolfsii isolate SR 4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 627 | 92.5% | 1215.62 | 0.00e+00 | 99.4% |
| 203 | OR578406 | Agroathelia rolfsii strain HJBJ-5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1209.67 | 0.00e+00 | 99.4% |
| 204 | PP231038 | Agroathelia rolfsii isolate HJBJ-9 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1209.67 | 0.00e+00 | 99.4% |
| 205 | MZ750979 | Agroathelia rolfsii strain LB6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 91.9% | 1207.69 | 0.00e+00 | 99.4% |
| 206 | MW450915 | Agroathelia rolfsii isolate UFT SrL1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 91.6% | 1201.74 | 0.00e+00 | 99.4% |
| 207 | OR400939 | Agroathelia rolfsii isolate SR1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 603 | 88.9% | 1170.03 | 0.00e+00 | 99.3% |
| 208 | KC420520 | Athelia rolfsii isolate SS-18 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 598 | 88.2% | 1160.12 | 0.00e+00 | 99.3% |
| 209 | OR048158 | Athelia rolfsii isolate Sr20 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 598 | 88.2% | 1160.12 | 0.00e+00 | 99.3% |
| 210 | DQ484060 | Athelia rolfsii isolate AFTOL-ID 664 clone 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 596 | 87.9% | 1154.17 | 0.00e+00 | 99.3% |
| 211 | OR338314 | Athelia rolfsii isolate Sr17 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 595 | 87.8% | 1152.19 | 0.00e+00 | 99.3% |
| 212 | OR167040 | Athelia rolfsii isolate KSR 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 580 | 85.5% | 1124.44 | 0.00e+00 | 99.3% |
| 213 | OR885522 | Agroathelia rolfsii isolate SR 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 560 | 82.6% | 1082.81 | 0.00e+00 | 99.3% |
| 214 | MW620998 | Agroathelia rolfsii isolate W12 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1283.02 | 0.00e+00 | 99.2% |
| 215 | MW620997 | Agroathelia rolfsii isolate W11 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1283.02 | 0.00e+00 | 99.2% |
| 216 | MW620996 | Agroathelia rolfsii isolate W10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1283.02 | 0.00e+00 | 99.2% |
| 217 | MW620995 | Agroathelia rolfsii isolate W9 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1283.02 | 0.00e+00 | 99.2% |
| 218 | MW620994 | Agroathelia rolfsii isolate W1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1283.02 | 0.00e+00 | 99.2% |
| 219 | OR981844 | Agroathelia rolfsii isolate KACC40944_C1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1281.03 | 0.00e+00 | 99.2% |
| 220 | OR981843 | Agroathelia rolfsii isolate KACC40832_C11 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1281.03 | 0.00e+00 | 99.2% |
| 221 | KT878487 | Agroathelia rolfsii isolate SR 23 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 649 | 95.7% | 1251.3 | 0.00e+00 | 99.2% |
| 222 | AB075310 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 156T18 | 645 | 95.1% | 1243.37 | 0.00e+00 | 99.2% |
| 223 | AB075307 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: WM909T2 | 645 | 95.1% | 1243.37 | 0.00e+00 | 99.2% |
| 224 | AB075292 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 63T20 | 645 | 95.1% | 1241.39 | 0.00e+00 | 99.2% |
| 225 | AB075288 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 63T10 | 645 | 95.1% | 1241.39 | 0.00e+00 | 99.2% |
| 226 | AB075289 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 63T15 | 645 | 95.1% | 1241.39 | 0.00e+00 | 99.2% |
| 227 | KC420519 | Athelia rolfsii isolate SS-17 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 631 | 93.1% | 1215.62 | 0.00e+00 | 99.2% |
| 228 | PP908474 | Agroathelia rolfsii isolate GKHaSr-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 630 | 92.9% | 1213.64 | 0.00e+00 | 99.2% |
| 229 | KC420518 | Athelia rolfsii isolate SS-16 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 630 | 92.9% | 1213.64 | 0.00e+00 | 99.2% |
| 230 | MZ751021 | Agroathelia rolfsii strain NC4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 626 | 92.3% | 1203.73 | 0.00e+00 | 99.2% |
| 231 | MZ751022 | Agroathelia rolfsii strain NC5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 626 | 92.3% | 1203.73 | 0.00e+00 | 99.2% |
| 232 | PQ881941 | Agroathelia rolfsii isolate ZC-01 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1201.74 | 0.00e+00 | 99.2% |
| 233 | MZ751018 | Agroathelia rolfsii strain NC1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1201.74 | 0.00e+00 | 99.2% |
| 234 | MN071107 | Agroathelia rolfsii strain NB1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1201.74 | 0.00e+00 | 99.2% |
| 235 | MZ751020 | Agroathelia rolfsii strain NC3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1201.74 | 0.00e+00 | 99.2% |
| 236 | MN071108 | Agroathelia rolfsii strain NB2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1201.74 | 0.00e+00 | 99.2% |
| 237 | MZ750976 | Agroathelia rolfsii strain LB2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 91.7% | 1195.8 | 0.00e+00 | 99.2% |
| 238 | MZ751027 | Agroathelia rolfsii strain NS3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 91.6% | 1193.81 | 0.00e+00 | 99.2% |
| 239 | OR143898 | Athelia rolfsii isolate AM1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 90.1% | 1179.94 | 0.00e+00 | 99.2% |
| 240 | MZ257199 | Agroathelia rolfsii strain FJAT-32624 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 591 | 87.2% | 1134.35 | 0.00e+00 | 99.2% |
| 241 | MZ257140 | Agroathelia rolfsii strain FJAT-32625 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 590 | 87.0% | 1132.36 | 0.00e+00 | 99.2% |
| 242 | MN421849 | Athelia rolfsii strain DNA2281 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1298.87 | 0.00e+00 | 99.1% |
| 243 | OR981856 | Agroathelia rolfsii isolate KACC93004P_C6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1273.1 | 0.00e+00 | 99.1% |
| 244 | OR981847 | Agroathelia rolfsii isolate KACC40944_C5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1273.1 | 0.00e+00 | 99.1% |
| 245 | OR981836 | Agroathelia rolfsii isolate KACC40832_C4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1273.1 | 0.00e+00 | 99.1% |
| 246 | MT126467 | Agroathelia rolfsii isolate (VDP) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 660 | 97.3% | 1263.19 | 0.00e+00 | 99.1% |
| 247 | AB075309 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 156T16 | 645 | 95.1% | 1235.44 | 0.00e+00 | 99.1% |
| 248 | AB075287 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 63T9 | 645 | 95.1% | 1233.46 | 0.00e+00 | 99.1% |
| 249 | JN241555 | Athelia rolfsii isolate SR2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1225.53 | 0.00e+00 | 99.1% |
| 250 | KC420513 | Athelia rolfsii isolate SS-11 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 638 | 94.1% | 1221.57 | 0.00e+00 | 99.1% |
| 251 | PV089368 | Agroathelia rolfsii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 93.8% | 1217.6 | 0.00e+00 | 99.1% |
| 252 | JX839988 | Athelia rolfsii isolate SR-NCIPM-1A 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 588 | 86.7% | 1130.38 | 0.00e+00 | 99.1% |
| 253 | MZ297242 | Agroathelia rolfsii strain FJAT-32609 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 579 | 85.4% | 1110.56 | 0.00e+00 | 99.1% |
| 254 | MZ297248 | Agroathelia rolfsii strain FJAT-32610 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 578 | 85.3% | 1108.58 | 0.00e+00 | 99.1% |
| 255 | MT119282 | Agroathelia rolfsii isolate 8664 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 563 | 83.0% | 1080.83 | 0.00e+00 | 99.1% |
| 256 | KJ677121 | Athelia rolfsii isolate BCRC30230 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 678 | 100.0% | 1292.93 | 0.00e+00 | 99.0% |
| 257 | ON524856 | Athelia rolfsii isolate CPSrZN03 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 669 | 98.7% | 1273.1 | 0.00e+00 | 99.0% |
| 258 | KU193744 | Agroathelia rolfsii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 620 | 91.4% | 1181.92 | 0.00e+00 | 99.0% |
| 259 | KP982853 | Athelia rolfsii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 613 | 90.4% | 1170.03 | 0.00e+00 | 99.0% |
| 260 | OQ231476 | Athelia rolfsii isolate Pr1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 663 | 97.8% | 1261.21 | 0.00e+00 | 98.9% |
| 261 | KY606616 | Agroathelia rolfsii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 662 | 97.6% | 1259.23 | 0.00e+00 | 98.9% |
| 262 | AB075302 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 43T6 | 645 | 95.1% | 1223.55 | 0.00e+00 | 98.9% |
| 263 | KJ578732 | Athelia rolfsii isolate CN16 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 638 | 94.1% | 1211.65 | 0.00e+00 | 98.9% |
| 264 | OM422750 | Athelia rolfsii isolate CSr7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 662 | 97.6% | 1263.19 | 0.00e+00 | 98.8% |
| 265 | KT878486 | Agroathelia rolfsii isolate SR 19 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 642 | 94.7% | 1213.64 | 0.00e+00 | 98.8% |
| 266 | KU096988 | Agroathelia rolfsii isolate SCG1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 589 | 86.9% | 1114.52 | 0.00e+00 | 98.8% |
| 267 | JQ004919 | Athelia rolfsii isolate SJNA4099 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 568 | 83.8% | 1072.9 | 0.00e+00 | 98.8% |
| 268 | MH260409 | Agroathelia rolfsii strain SR5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 634 | 93.5% | 1197.78 | 0.00e+00 | 98.7% |
| 269 | OP658949 | Athelia rolfsii isolate MY17B-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 626 | 92.3% | 1179.94 | 0.00e+00 | 98.7% |
| 270 | MN298760 | Agroathelia rolfsii isolate AGSV24 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 663 | 97.8% | 1239.41 | 0.00e+00 | 98.6% |
| 271 | MN298759 | Agroathelia rolfsii isolate AGSV23 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 658 | 97.1% | 1229.5 | 0.00e+00 | 98.6% |
| 272 | MH982248 | Agroathelia rolfsii isolate BLL_2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 644 | 95.0% | 1207.69 | 0.00e+00 | 98.6% |
| 273 | MZ750975 | Agroathelia rolfsii strain LB1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 91.9% | 1166.06 | 0.00e+00 | 98.6% |
| 274 | MT017573 | Agroathelia rolfsii isolate SrB2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1267.16 | 0.00e+00 | 98.5% |
| 275 | KT750883 | Agroathelia rolfsii strain FP15 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 654 | 96.5% | 1219.58 | 0.00e+00 | 98.5% |
| 276 | PP908475 | Agroathelia rolfsii isolate TKHaSr-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 610 | 90.0% | 1142.28 | 0.00e+00 | 98.5% |
| 277 | GQ148561 | Athelia rolfsii isolate S-08 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 606 | 89.4% | 1132.36 | 0.00e+00 | 98.5% |
| 278 | MF033903 | Agroathelia rolfsii isolate BJB24 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 595 | 87.8% | 1112.54 | 0.00e+00 | 98.5% |
| 279 | MW174211 | Agroathelia rolfsii isolate svpuat internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 91.9% | 1160.12 | 0.00e+00 | 98.4% |
| 280 | MZ750971 | Agroathelia rolfsii strain HS7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 91.6% | 1154.17 | 0.00e+00 | 98.4% |
| 281 | MT535585 | Agroathelia rolfsii isolate 8666 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 93.8% | 1175.97 | 0.00e+00 | 98.3% |
| 282 | ON786622 | Athelia rolfsii isolate AR-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 595 | 87.8% | 1102.63 | 0.00e+00 | 98.3% |
| 283 | OR047868 | Athelia rolfsii isolate Sr10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 571 | 84.2% | 1059.02 | 0.00e+00 | 98.3% |
| 284 | MT012545 | Agroathelia rolfsii isolate SrC2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1251.3 | 0.00e+00 | 98.2% |
| 285 | MZ701841 | Agroathelia rolfsii strain SBM1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1231.48 | 0.00e+00 | 98.2% |
| 286 | MZ750965 | Agroathelia rolfsii strain HS1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 91.4% | 1144.26 | 0.00e+00 | 98.2% |
| 287 | MH514004 | Agroathelia rolfsii isolate MA-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 675 | 99.6% | 1243.37 | 0.00e+00 | 98.1% |
| 288 | MT535584 | Agroathelia rolfsii isolate 8646 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 93.8% | 1168.04 | 0.00e+00 | 98.1% |
| 289 | MT026581 | Agroathelia rolfsii isolate IGFRI 1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 612 | 90.3% | 1124.44 | 0.00e+00 | 98.0% |
| 290 | MT017575 | Agroathelia rolfsii isolate SrD1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1235.44 | 0.00e+00 | 97.9% |
| 291 | LC835670 | Agroathelia rolfsii NK1 genes for ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 676 | 99.7% | 1233.46 | 0.00e+00 | 97.9% |
| 292 | MT337402 | Agroathelia rolfsii isolate Al09 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 656 | 96.8% | 1191.83 | 0.00e+00 | 97.9% |
| 293 | OQ442345 | Athelia rolfsii isolate WAS2020 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 615 | 90.7% | 1120.47 | 0.00e+00 | 97.9% |
| 294 | MH256035 | Agroathelia rolfsii isolate FZ0816 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 575 | 84.8% | 1047.13 | 0.00e+00 | 97.9% |
| 295 | MT017586 | Agroathelia rolfsii isolate SrY1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1229.5 | 0.00e+00 | 97.8% |
| 296 | MT017581 | Agroathelia rolfsii isolate SrP1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1227.51 | 0.00e+00 | 97.8% |
| 297 | MH571744 | Agroathelia rolfsii strain KACC 48132 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1203.73 | 0.00e+00 | 97.8% |
| 298 | AB075285 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 35T3 | 645 | 95.1% | 1170.03 | 0.00e+00 | 97.8% |
| 299 | OR981866 | Agroathelia rolfsii isolate KACC43065_C10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1203.73 | 0.00e+00 | 97.7% |
| 300 | MT126473 | Agroathelia rolfsii isolate NTNM small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 661 | 97.5% | 1197.78 | 0.00e+00 | 97.7% |
| 301 | MT337401 | Agroathelia rolfsii isolate Cc06 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 656 | 96.8% | 1183.9 | 0.00e+00 | 97.7% |
| 302 | MT017576 | Agroathelia rolfsii isolate SrC1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1219.58 | 0.00e+00 | 97.6% |
| 303 | MH514003 | Agroathelia rolfsii isolate CH-2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 675 | 99.6% | 1213.64 | 0.00e+00 | 97.6% |
| 304 | MW026139 | Agroathelia rolfsii isolate SrPh1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1195.8 | 0.00e+00 | 97.6% |
| 305 | MZ750974 | Agroathelia rolfsii strain HS10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 91.4% | 1112.54 | 0.00e+00 | 97.6% |
| 306 | MN650825 | Agroathelia rolfsii isolate 8402 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1189.85 | 0.00e+00 | 97.5% |
| 307 | MT017583 | Agroathelia rolfsii isolate SrY2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 651 | 96.0% | 1168.04 | 0.00e+00 | 97.5% |
| 308 | MT126469 | Agroathelia rolfsii isolate (MDK) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 663 | 97.8% | 1183.9 | 0.00e+00 | 97.4% |
| 309 | PV241734 | Agroathelia rolfsii isolate BR small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 635 | 93.7% | 1128.4 | 0.00e+00 | 97.3% |
| 310 | KC543584 | Athelia rolfsii strain physr1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 596 | 87.9% | 1059.02 | 0.00e+00 | 97.3% |
| 311 | JQ982485 | Sclerotium delphinii strain Sd-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 617 | 91.0% | 1090.74 | 0.00e+00 | 97.2% |
| 312 | MT017578 | Agroathelia rolfsii isolate SrD2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1189.85 | 0.00e+00 | 97.1% |
| 313 | MH514002 | Agroathelia rolfsii isolate CH-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 675 | 99.6% | 1185.89 | 0.00e+00 | 97.1% |
| 314 | OR981854 | Agroathelia rolfsii isolate KACC93004P_C4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1168.04 | 0.00e+00 | 97.1% |
| 315 | ON714913 | Athelia rolfsii isolate SRNAGPUR internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 651 | 96.0% | 1146.24 | 0.00e+00 | 97.1% |
| 316 | ON714914 | Athelia rolfsii isolate SRRAIPUR internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 650 | 95.9% | 1144.26 | 0.00e+00 | 97.1% |
| 317 | MZ750988 | Agroathelia rolfsii strain RH3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 92.0% | 1098.67 | 0.00e+00 | 97.1% |
| 318 | OK275413 | Agroathelia rolfsii isolate 17-4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 91.9% | 1096.68 | 0.00e+00 | 97.1% |
| 319 | PQ417144 | Agroathelia rolfsii strain S1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 91.4% | 1094.7 | 0.00e+00 | 97.1% |
| 320 | OP349638 | Athelia rolfsii isolate WUJIANG01 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 619 | 91.3% | 1086.77 | 0.00e+00 | 97.1% |
| 321 | OQ348492 | Athelia rolfsii isolate GSR8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1166.06 | 0.00e+00 | 97.0% |
| 322 | MW258757 | Agroathelia rolfsii isolate SrTn-2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 596 | 87.9% | 1043.16 | 0.00e+00 | 97.0% |
| 323 | AB075296 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 63T103 | 645 | 95.1% | 1122.45 | 0.00e+00 | 96.9% |
| 324 | OR912462 | Agroathelia rolfsii isolate 7_ITS1-F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 638 | 94.1% | 1110.56 | 0.00e+00 | 96.9% |
| 325 | MT017572 | Agroathelia rolfsii isolate SrB1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1172.01 | 0.00e+00 | 96.8% |
| 326 | MZ242243 | Agroathelia delphinii isolate Akln9 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 677 | 99.9% | 1170.03 | 0.00e+00 | 96.8% |
| 327 | MT812692 | Agroathelia rolfsii isolate CZL1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1152.19 | 0.00e+00 | 96.8% |
| 328 | MK418758 | Agroathelia rolfsii strain zzsc1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 616 | 90.9% | 1064.97 | 0.00e+00 | 96.8% |
| 329 | ON524853 | Athelia rolfsii isolate CPSrZN02 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 672 | 99.1% | 1164.08 | 0.00e+00 | 96.7% |
| 330 | ON524854 | Athelia rolfsii isolate CPSrZN01 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 669 | 98.7% | 1158.13 | 0.00e+00 | 96.7% |
| 331 | MG646006 | Agroathelia rolfsii strain SYHX-2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1144.26 | 0.00e+00 | 96.7% |
| 332 | OR981830 | Agroathelia delphinii isolate KACC93031P_C6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1142.28 | 0.00e+00 | 96.7% |
| 333 | JN241559 | Athelia rolfsii isolate 1810 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 94.2% | 1112.54 | 0.00e+00 | 96.7% |
| 334 | OR912464 | Agroathelia rolfsii isolate 9_ITS1-F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 93.8% | 1098.67 | 0.00e+00 | 96.7% |
| 335 | PP126491 | Agroathelia rolfsii isolate I6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 94.4% | 1086.77 | 0.00e+00 | 96.7% |
| 336 | ON524858 | Athelia rolfsii isolate CPSrZN06 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 626 | 92.3% | 1082.81 | 0.00e+00 | 96.7% |
| 337 | PP766015 | Agroathelia rolfsii strain DM1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 606 | 89.4% | 1045.14 | 0.00e+00 | 96.7% |
| 338 | MZ242242 | Agroathelia delphinii isolate Akln6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 676 | 99.7% | 1160.12 | 0.00e+00 | 96.6% |
| 339 | MW349664 | Agroathelia rolfsii isolate GKVK Brinjal small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 671 | 99.0% | 1152.19 | 0.00e+00 | 96.6% |
| 340 | MH855140 | [Sclerotium] delphinii culture CBS:272.30 strain CBS 272.30 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 673 | 99.3% | 1152.19 | 0.00e+00 | 96.6% |
| 341 | KU514414 | Agroathelia rolfsii isolate SrKK19_1090 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 666 | 98.2% | 1140.29 | 0.00e+00 | 96.6% |
| 342 | MN872304 | Agroathelia rolfsii isolate Kale078 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1140.29 | 0.00e+00 | 96.6% |
| 343 | LC835020 | Agroathelia delphinii BOS-AYA001 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1106.59 | 0.00e+00 | 96.6% |
| 344 | LC835014 | Agroathelia delphinii BOS-SPB002 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1106.59 | 0.00e+00 | 96.6% |
| 345 | OP369074 | Athelia rolfsii strain BRIP 39302 copy 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 95.1% | 1106.59 | 0.00e+00 | 96.6% |
| 346 | OK275401 | Agroathelia rolfsii isolate FZCG190612 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 640 | 94.4% | 1096.68 | 0.00e+00 | 96.6% |
| 347 | MZ242247 | Agroathelia delphinii isolate Ahln1053 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 94.4% | 1096.68 | 0.00e+00 | 96.6% |
| 348 | MZ242244 | Agroathelia delphinii isolate Akln15 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 94.4% | 1096.68 | 0.00e+00 | 96.6% |
| 349 | MZ750985 | Agroathelia rolfsii strain QX1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 91.6% | 1070.91 | 0.00e+00 | 96.6% |
| 350 | MZ750983 | Agroathelia rolfsii strain QJ5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 619 | 91.3% | 1064.97 | 0.00e+00 | 96.6% |
| 351 | OL150603 | Agroathelia rolfsii isolate GNS1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 89.7% | 1043.16 | 0.00e+00 | 96.6% |
| 352 | KP214032 | Athelia rolfsii isolate KACC47818 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 678 | 100.0% | 1156.15 | 0.00e+00 | 96.5% |
| 353 | GQ358518 | Athelia rolfsii strain orchid 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 678 | 100.0% | 1156.15 | 0.00e+00 | 96.5% |
| 354 | MZ242245 | Agroathelia delphinii isolate Acln1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 677 | 99.9% | 1154.17 | 0.00e+00 | 96.5% |
| 355 | MK288124 | Agroathelia rolfsii isolate Tr_Stevia AR-02 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 677 | 99.9% | 1154.17 | 0.00e+00 | 96.5% |
| 356 | OR981857 | Agroathelia rolfsii isolate KACC93004P_C7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1136.33 | 0.00e+00 | 96.5% |
| 357 | MT812693 | Agroathelia rolfsii isolate CZL1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1136.33 | 0.00e+00 | 96.5% |
| 358 | OR981851 | Agroathelia rolfsii isolate KACC93004P_C1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1136.33 | 0.00e+00 | 96.5% |
| 359 | OR981846 | Agroathelia rolfsii isolate KACC40944_C3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1136.33 | 0.00e+00 | 96.5% |
| 360 | KJ552090 | Athelia rolfsii strain bai2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 663 | 97.8% | 1134.35 | 0.00e+00 | 96.5% |
| 361 | MW258734 | Agroathelia rolfsii isolate SrKa-19 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 661 | 97.5% | 1132.36 | 0.00e+00 | 96.5% |
| 362 | KT222898 | Athelia rolfsii strain 13M-0091 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 659 | 97.2% | 1130.38 | 0.00e+00 | 96.5% |
| 363 | OQ608630 | Athelia rolfsii isolate ArGS2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 652 | 96.2% | 1112.54 | 0.00e+00 | 96.5% |
| 364 | OP020439 | Athelia rolfsii isolate Esc1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 649 | 95.7% | 1106.59 | 0.00e+00 | 96.5% |
| 365 | MZ750964 | Agroathelia rolfsii strain HG6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1064.97 | 0.00e+00 | 96.5% |
| 366 | MH856168 | [Sclerotium] delphinii culture CBS:221.46 strain CBS 221.46 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 673 | 99.3% | 1148.22 | 0.00e+00 | 96.4% |
| 367 | MF776034 | Agroathelia rolfsii isolate DG92 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 668 | 98.5% | 1138.31 | 0.00e+00 | 96.4% |
| 368 | MN622806 | Agroathelia rolfsii isolate BX small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1134.35 | 0.00e+00 | 96.4% |
| 369 | PP835396 | Agroathelia rolfsii isolate YK1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1134.35 | 0.00e+00 | 96.4% |
| 370 | MN610000 | Agroathelia rolfsii isolate MSB1-2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1132.36 | 0.00e+00 | 96.4% |
| 371 | MH542664 | Agroathelia rolfsii isolate Aconitum carmichaelii Debx small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1132.36 | 0.00e+00 | 96.4% |
| 372 | ON524855 | Athelia rolfsii isolate CPSrZN05 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1132.36 | 0.00e+00 | 96.4% |
| 373 | MK424482 | Agroathelia rolfsii isolate YG2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1130.38 | 0.00e+00 | 96.4% |
| 374 | OR981869 | Agroathelia rolfsii isolate KACC45483_C3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1130.38 | 0.00e+00 | 96.4% |
| 375 | KU514413 | Agroathelia rolfsii isolate SrKK18_1090 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1130.38 | 0.00e+00 | 96.4% |
| 376 | HM355751 | Athelia rolfsii strain KACC42087 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1130.38 | 0.00e+00 | 96.4% |
| 377 | KU760983 | Athelia rolfsii isolate MHGNU F117 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1130.38 | 0.00e+00 | 96.4% |
| 378 | OM946593 | Athelia rolfsii isolate MB-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1128.4 | 0.00e+00 | 96.4% |
| 379 | OR981834 | Agroathelia rolfsii isolate KACC40832_C2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 663 | 97.8% | 1128.4 | 0.00e+00 | 96.4% |
| 380 | MT126475 | Agroathelia rolfsii isolate KPT small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 661 | 97.5% | 1122.45 | 0.00e+00 | 96.4% |
| 381 | KT222899 | Athelia rolfsii strain 13M-0081 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 659 | 97.2% | 1122.45 | 0.00e+00 | 96.4% |
| 382 | KC292637 | Athelia rolfsii strain SclerotiumSr3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 656 | 96.8% | 1114.52 | 0.00e+00 | 96.4% |
| 383 | LC835021 | Agroathelia delphinii BOS-AYA002 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1098.67 | 0.00e+00 | 96.4% |
| 384 | AB042626 | Athelia rolfsii genes for nuclear small rRNA, ITS1, 5.8S rRNA, ITS2, nuclear large rRNA, partial and complete sequence | 645 | 95.1% | 1098.67 | 0.00e+00 | 96.4% |
| 385 | LC835016 | Agroathelia delphinii BOS-NPT002 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1098.67 | 0.00e+00 | 96.4% |
| 386 | LC835019 | Agroathelia delphinii BOS-AYA004 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1098.67 | 0.00e+00 | 96.4% |
| 387 | LC835017 | Agroathelia delphinii BOS-NPT003 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1098.67 | 0.00e+00 | 96.4% |
| 388 | JN241566 | Sclerotium delphinii isolate CBS843.84 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1088.75 | 0.00e+00 | 96.4% |
| 389 | KT222901 | Athelia rolfsii strain 13M-0083 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1088.75 | 0.00e+00 | 96.4% |
| 390 | OR912459 | Agroathelia rolfsii isolate 4_ITS1-F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 638 | 94.1% | 1084.79 | 0.00e+00 | 96.4% |
| 391 | KT222900 | Athelia rolfsii strain 13M-0067 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 633 | 93.4% | 1074.88 | 0.00e+00 | 96.4% |
| 392 | MN523337 | Agroathelia rolfsii strain X-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 631 | 93.1% | 1068.93 | 0.00e+00 | 96.4% |
| 393 | MT023434 | Agroathelia rolfsii isolate Ar2019 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 612 | 90.3% | 1041.18 | 0.00e+00 | 96.4% |
| 394 | AY684916 | Athelia rolfsii strain FSR-049 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 664 | 97.9% | 1124.44 | 0.00e+00 | 96.3% |
| 395 | OR981839 | Agroathelia rolfsii isolate KACC40832_C7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1122.45 | 0.00e+00 | 96.3% |
| 396 | OR981867 | Agroathelia rolfsii isolate KACC45483_C1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1122.45 | 0.00e+00 | 96.3% |
| 397 | MT982752 | Agroathelia rolfsii isolate WYBJ-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1122.45 | 0.00e+00 | 96.3% |
| 398 | MK424481 | Agroathelia rolfsii isolate YG1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 665 | 98.1% | 1122.45 | 0.00e+00 | 96.3% |
| 399 | KU854983 | Agroathelia rolfsii strain s20 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 653 | 96.3% | 1108.58 | 0.00e+00 | 96.3% |
| 400 | MH858139 | Athelia rolfsii culture CBS:191.62 strain CBS 191.62 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 653 | 96.3% | 1106.59 | 0.00e+00 | 96.3% |
| 401 | PV271945 | Agroathelia rolfsii isolate AgrSt-07 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 650 | 95.9% | 1102.63 | 0.00e+00 | 96.3% |
| 402 | OP278949 | Athelia rolfsii isolate GZCC 22-0087 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 650 | 95.9% | 1100.65 | 0.00e+00 | 96.3% |
| 403 | MZ328849 | Agroathelia rolfsii strain Ar-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 648 | 95.6% | 1098.67 | 0.00e+00 | 96.3% |
| 404 | PP349785 | Agroathelia rolfsii isolate GCS-2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 647 | 95.4% | 1098.67 | 0.00e+00 | 96.3% |
| 405 | LC835013 | Agroathelia delphinii BOS-SPB001 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1090.74 | 0.00e+00 | 96.3% |
| 406 | LC835015 | Agroathelia delphinii BOS-NPT001 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1090.74 | 0.00e+00 | 96.3% |
| 407 | AB075298 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 63T108 | 645 | 95.1% | 1090.74 | 0.00e+00 | 96.3% |
| 408 | PP349786 | Agroathelia rolfsii isolate GCS-3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 641 | 94.5% | 1086.77 | 0.00e+00 | 96.3% |
| 409 | PP349787 | Agroathelia rolfsii isolate GCS-4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 94.4% | 1084.79 | 0.00e+00 | 96.3% |
| 410 | KT222909 | Athelia rolfsii strain 13M-0086 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1082.81 | 0.00e+00 | 96.3% |
| 411 | OM021880 | Agroathelia rolfsii isolate SrSh7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 641 | 94.5% | 1082.81 | 0.00e+00 | 96.3% |
| 412 | ON815116 | Athelia rolfsii isolate Davanagere internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 628 | 92.6% | 1064.97 | 0.00e+00 | 96.3% |
| 413 | MN585915 | Agroathelia rolfsii isolate SBVA819 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 628 | 92.6% | 1062.99 | 0.00e+00 | 96.3% |
| 414 | JX566993 | Athelia rolfsii culture-collection CBS:132553 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 624 | 92.0% | 1057.04 | 0.00e+00 | 96.3% |
| 415 | KJ002761 | Athelia rolfsii isolate MKS1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 624 | 92.0% | 1057.04 | 0.00e+00 | 96.3% |
| 416 | MZ750977 | Agroathelia rolfsii strain LB4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 91.7% | 1053.07 | 0.00e+00 | 96.3% |
| 417 | MZ751010 | Agroathelia rolfsii strain LH5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 91.4% | 1049.11 | 0.00e+00 | 96.3% |
| 418 | ON810537 | Athelia rolfsii isolate Shivamogga internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 617 | 91.0% | 1045.14 | 0.00e+00 | 96.3% |
| 419 | MN915128 | Agroathelia rolfsii strain BQ1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 617 | 91.0% | 1045.14 | 0.00e+00 | 96.3% |
| 420 | MT305816 | Agroathelia rolfsii isolate SrIb_8 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 617 | 91.0% | 1045.14 | 0.00e+00 | 96.3% |
| 421 | ON786704 | Athelia rolfsii isolate Sr 5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 90.9% | 1043.16 | 0.00e+00 | 96.3% |
| 422 | MZ750968 | Agroathelia rolfsii strain HS4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 618 | 91.2% | 1043.16 | 0.00e+00 | 96.3% |
| 423 | MZ751007 | Agroathelia rolfsii strain ZH7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 90.9% | 1043.16 | 0.00e+00 | 96.3% |
| 424 | MZ751004 | Agroathelia rolfsii strain ZH4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 615 | 90.7% | 1041.18 | 0.00e+00 | 96.3% |
| 425 | OK275400 | Agroathelia rolfsii isolate FZCG190601 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 616 | 90.9% | 1041.18 | 0.00e+00 | 96.3% |
| 426 | OQ134754 | Athelia rolfsii isolate Sr-E30C small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 677 | 99.9% | 1138.31 | 0.00e+00 | 96.2% |
| 427 | KM434132 | Athelia rolfsii isolate BPScl 01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 677 | 99.9% | 1138.31 | 0.00e+00 | 96.2% |
| 428 | MW026140 | Agroathelia rolfsii isolate SrPh2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1120.47 | 0.00e+00 | 96.2% |
| 429 | OR981827 | Agroathelia delphinii isolate KACC93031P_C3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1120.47 | 0.00e+00 | 96.2% |
| 430 | MT126468 | Agroathelia rolfsii isolate (PLM) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 662 | 97.6% | 1114.52 | 0.00e+00 | 96.2% |
| 431 | MF428429 | Agroathelia rolfsii isolate EBAGRO small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 658 | 97.1% | 1110.56 | 0.00e+00 | 96.2% |
| 432 | PP430392 | Agroathelia rolfsii strain CCI01 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 657 | 96.9% | 1106.59 | 0.00e+00 | 96.2% |
| 433 | OM057486 | Agroathelia rolfsii strain MNG-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 648 | 95.6% | 1088.75 | 0.00e+00 | 96.2% |
| 434 | OR912461 | Agroathelia rolfsii isolate 6_ITS1-F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 93.8% | 1072.9 | 0.00e+00 | 96.2% |
| 435 | OM021879 | Agroathelia rolfsii isolate SrSh4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 632 | 93.2% | 1064.97 | 0.00e+00 | 96.2% |
| 436 | MN535048 | Agroathelia rolfsii isolate PGCHES001 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 631 | 93.1% | 1062.99 | 0.00e+00 | 96.2% |
| 437 | PQ012596 | Agroathelia rolfsii strain HJB3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 630 | 92.9% | 1061.0 | 0.00e+00 | 96.2% |
| 438 | MT127466 | Agroathelia rolfsii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 626 | 92.3% | 1051.09 | 0.00e+00 | 96.2% |
| 439 | MN908605 | Agroathelia rolfsii strain SR22 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1049.11 | 0.00e+00 | 96.2% |
| 440 | MZ750997 | Agroathelia rolfsii strain ZB3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 92.0% | 1049.11 | 0.00e+00 | 96.2% |
| 441 | MZ751006 | Agroathelia rolfsii strain ZH6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 91.9% | 1047.13 | 0.00e+00 | 96.2% |
| 442 | MZ751003 | Agroathelia rolfsii strain ZH3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 91.9% | 1047.13 | 0.00e+00 | 96.2% |
| 443 | MZ751005 | Agroathelia rolfsii strain ZH5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 91.9% | 1047.13 | 0.00e+00 | 96.2% |
| 444 | MZ751008 | Agroathelia rolfsii strain ZH8 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 91.9% | 1047.13 | 0.00e+00 | 96.2% |
| 445 | MZ751002 | Agroathelia rolfsii strain ZH2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 91.7% | 1045.14 | 0.00e+00 | 96.2% |
| 446 | MZ750996 | Agroathelia rolfsii strain ZB2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 91.7% | 1045.14 | 0.00e+00 | 96.2% |
| 447 | MZ751001 | Agroathelia rolfsii strain ZH1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 91.7% | 1045.14 | 0.00e+00 | 96.2% |
| 448 | MW916955 | Agroathelia delphinii isolate YKY2020.01 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 623 | 91.9% | 1045.14 | 0.00e+00 | 96.2% |
| 449 | OR981837 | Agroathelia rolfsii isolate KACC40832_C5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1114.52 | 0.00e+00 | 96.1% |
| 450 | OR981863 | Agroathelia rolfsii isolate KACC43065_C6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1114.52 | 0.00e+00 | 96.1% |
| 451 | OR981861 | Agroathelia rolfsii isolate KACC43065_C4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1114.52 | 0.00e+00 | 96.1% |
| 452 | ON182067 | Athelia rolfsii strain KACC 48540 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1114.52 | 0.00e+00 | 96.1% |
| 453 | OR981875 | Agroathelia rolfsii isolate KACC45483_C10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1114.52 | 0.00e+00 | 96.1% |
| 454 | JN543691 | Athelia rolfsii strain VrNY 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 662 | 97.6% | 1108.58 | 0.00e+00 | 96.1% |
| 455 | AB075299 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 1T5 | 645 | 95.1% | 1084.79 | 0.00e+00 | 96.1% |
| 456 | LC835022 | Agroathelia delphinii BOS-AYA003 genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, LSU rRNA, partial and complete sequence | 645 | 95.1% | 1082.81 | 0.00e+00 | 96.1% |
| 457 | OR661262 | Agroathelia rolfsii isolate Sr25 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 638 | 94.1% | 1070.91 | 0.00e+00 | 96.1% |
| 458 | OR912460 | Agroathelia rolfsii isolate 5_ITS1-F internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 638 | 94.1% | 1068.93 | 0.00e+00 | 96.1% |
| 459 | OL884217 | Agroathelia rolfsii isolate PA-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 638 | 94.1% | 1066.95 | 0.00e+00 | 96.1% |
| 460 | ON524857 | Athelia rolfsii isolate CPSrZN04 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 672 | 99.1% | 1124.44 | 0.00e+00 | 96.0% |
| 461 | ON524859 | Athelia rolfsii isolate CPSrZN07 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 672 | 99.1% | 1124.44 | 0.00e+00 | 96.0% |
| 462 | OR981865 | Agroathelia rolfsii isolate KACC43065_C9 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1106.59 | 0.00e+00 | 96.0% |
| 463 | OK172559 | Agroathelia rolfsii isolate HelleboreMD small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1106.59 | 0.00e+00 | 96.0% |
| 464 | OR981872 | Agroathelia rolfsii isolate KACC45483_C6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 664 | 97.9% | 1106.59 | 0.00e+00 | 96.0% |
| 465 | MH260413 | Agroathelia rolfsii strain SR10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 653 | 96.3% | 1096.68 | 0.00e+00 | 96.0% |
| 466 | KC420509 | Athelia rolfsii isolate SS-06 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 652 | 96.2% | 1088.75 | 0.00e+00 | 96.0% |
| 467 | KC420516 | Athelia rolfsii isolate SS-14 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 650 | 95.9% | 1084.79 | 0.00e+00 | 96.0% |
| 468 | KT222902 | Athelia rolfsii strain 13M-0093 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 648 | 95.6% | 1080.83 | 0.00e+00 | 96.0% |
| 469 | AB075311 | Sclerotium delphinii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 32T2 | 645 | 95.1% | 1076.86 | 0.00e+00 | 96.0% |
| 470 | AB075316 | Sclerotium delphinii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 196T14 | 645 | 95.1% | 1076.86 | 0.00e+00 | 96.0% |
| 471 | LC371689 | Athelia rolfsii TS2 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 645 | 95.1% | 1076.86 | 0.00e+00 | 96.0% |
| 472 | AB075297 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 63T105 | 645 | 95.1% | 1074.88 | 0.00e+00 | 96.0% |
| 473 | AB075301 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: 43T5 | 644 | 95.0% | 1068.93 | 0.00e+00 | 96.0% |
| 474 | KT222910 | Athelia rolfsii strain 13M-0065 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1068.93 | 0.00e+00 | 96.0% |
| 475 | JN241573 | Sclerotium delphinii isolate CBS720.83 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1066.95 | 0.00e+00 | 96.0% |
| 476 | MZ751011 | Agroathelia rolfsii strain LY3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 625 | 92.2% | 1043.16 | 0.00e+00 | 96.0% |
| 477 | MW800352 | Agroathelia rolfsii isolate 7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 661 | 97.5% | 1098.67 | 0.00e+00 | 95.9% |
| 478 | KC420514 | Athelia rolfsii isolate SS-12 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 653 | 96.3% | 1082.81 | 0.00e+00 | 95.9% |
| 479 | OQ608625 | Athelia rolfsii isolate ArGS1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 652 | 96.2% | 1082.81 | 0.00e+00 | 95.9% |
| 480 | OR492009 | Agroathelia rolfsii isolate FDACS-DPI PPST 2020-105211 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 635 | 93.7% | 1055.06 | 0.00e+00 | 95.9% |
| 481 | MN646214 | Agroathelia rolfsii isolate RS-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 629 | 92.8% | 1043.16 | 0.00e+00 | 95.9% |
| 482 | KT428156 | Athelia rolfsii strain BLH-02 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 657 | 96.9% | 1082.81 | 0.00e+00 | 95.8% |
| 483 | PP780303 | Agroathelia rolfsii isolate M39KB small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 93.4% | 1045.14 | 0.00e+00 | 95.8% |
| 484 | PP831679 | Agroathelia rolfsii isolate MO511744 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1152.19 | 0.00e+00 | 95.7% |
| 485 | OM349645 | Athelia rolfsii isolate CSr10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 663 | 97.8% | 1102.63 | 0.00e+00 | 95.7% |
| 486 | MK087754 | Agroathelia rolfsii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 651 | 96.0% | 1434.159 | 0.00e+00 | 95.7% |
| 487 | KC420515 | Athelia rolfsii isolate SS-13 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 653 | 96.3% | 1074.88 | 0.00e+00 | 95.7% |
| 488 | MN540637 | Agroathelia rolfsii isolate SrStem3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1108.58 | 0.00e+00 | 95.6% |
| 489 | MF431744 | Agroathelia rolfsii isolate DMM 343 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 672 | 99.1% | 1098.67 | 0.00e+00 | 95.6% |
| 490 | JF775507 | Athelia rolfsii strain A01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 662 | 97.6% | 1082.81 | 0.00e+00 | 95.6% |
| 491 | MH260414 | Agroathelia rolfsii strain SR11 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 651 | 96.0% | 1074.88 | 0.00e+00 | 95.6% |
| 492 | JN241572 | Sclerotium delphinii isolate CBS102.89 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 94.4% | 1049.11 | 0.00e+00 | 95.6% |
| 493 | KT319126 | Uncultured Athelia clone 4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 650 | 95.9% | 1066.95 | 0.00e+00 | 95.5% |
| 494 | AB075317 | Sclerotium delphinii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, clone: W10T14 | 645 | 95.1% | 1047.13 | 0.00e+00 | 95.5% |
| 495 | MF817710 | Agroathelia rolfsii isolate Viamao-FEPAGRO internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 614 | 90.6% | 1092.72 | 0.00e+00 | 95.4% |
| 496 | LC191268 | Athelia rolfsii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 651 | 96.0% | 1053.07 | 0.00e+00 | 95.4% |
| 497 | KT768136 | Agroathelia rolfsii isolate SrOc1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 650 | 95.9% | 1051.09 | 0.00e+00 | 95.4% |
| 498 | MN535047 | Agroathelia rolfsii isolate PGKEND002 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 672 | 99.1% | 1062.99 | 0.00e+00 | 94.9% |
| 499 | MW258721 | Agroathelia rolfsii isolate SrKa-8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 678 | 100.0% | 1061.0 | 0.00e+00 | 94.7% |
| 500 | OQ348491 | Athelia rolfsii isolate GSR_5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 666 | 98.2% | 1104.61 | 0.00e+00 | 92.8% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the distribution of BLAST hits identity within each genus. Each data point shows the alignment identity between the query sequence and reference sequence. The analyst may wish to refer to this figure when making a subjective genus-level identification for the sample.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |